콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU026571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmox1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAAATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTCTTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTC

Ensembl | 마우스 수납 번호

ENSMUSG00000005413

NCBI 수납 번호

NM_010442

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... HMOX1(15368) , Hmox1(15368)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiao Qiao Wang et al.
Biomedical and environmental sciences : BES, 27(10), 786-793 (2014-10-25)
To assess the effect of atorvastatin on lipopolysaccharide (LPS)-induced TNF-α production in RAW264.7 macrophages. RAW264.7 macrophages were treated in different LPS concentrations or at different time points with or without atorvastatin. TNF-α level in supernatant was measured. Expressions of TNF-α
So Ra Kim et al.
Biochemical pharmacology, 95(4), 279-289 (2015-04-22)
High mobility group box 1 (HMGB1) is now recognized as a late mediator of sepsis. We tested hypothesis that ascorbic acid (AscA) induces heme oxygenase (HO)-1 which inhibits HMGB1 release in lipopolysaccharide (LPS)-stimulated cells and increases survival of septic mice.
Yun-Jeong Choe et al.
International journal of oncology, 44(3), 761-768 (2013-12-25)
A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1
Lilibeth Lanceta et al.
PloS one, 10(8), e0134144-e0134144 (2015-08-14)
Earlier observations indicate that free heme is selectively toxic to cells lacking heme oxygenase-1 (HO-1) but how this enzyme prevents heme toxicity remains unexplained. Here, using A549 (human lung cancer) and immortalized human bronchial epithelial cells incubated with exogenous heme
Li-Chin Sung et al.
Clinical and experimental pharmacology & physiology, 42(6), 632-639 (2015-05-02)
Lycopene is the most potent active antioxidant among the major carotenoids, and its use has been associated with a reduced risk for cardiovascular disease (CVD). Endothelin-1 (ET-1) is a powerful vasopressor synthesized by endothelial cells and plays a crucial role
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.