추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AATGGACCTGTCAGCCAATCAGGATGAAGAGACCGATCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACAAGAAAGTGTGCCTTTCGCACCCACACGGGCAAGTACTGGACACTGACGGCGACCGGAGGTGTGCAATCCACTGCGTCCACCAAGAACGCCAGCTGCTACTTTGACATCGAGTGGTGTGACCGCCGGATCACTCTGAGAGCCTCCAACGGCAAGTTTGTGACCGCCAAGAAAAATGGCCACGTGGCCGCCTCGGTGGAGACAGCAGGGGACTCGGAACTCTTCCTCATGAAGCTGATTAACCGCCCCATCATTGCGTTCCGGGGGGAACACGGGTTCATTGCGTGCCGCAAGGTCACGGGCACTCTGGATGCCAACCGTTCCAGTTACGATGTCTTCCAGTTGGAATTCAATGACGGCGCCTACAACATCAAAGACTCCACGGG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... Fscn1(14086)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jia-jia Chen et al.
PloS one, 10(5), e0126890-e0126890 (2015-05-27)
MicroRNAs (miRs) play important roles in modulating gene expression during the processes of tumorigenesis and tumor development. Previous studies have found that miR-145 is down-regulated in the stomach neoplasm and is related to tumor migration and invasion. However, both the
Yunshan Yang et al.
PloS one, 10(5), e0125132-e0125132 (2015-05-21)
Fas signaling-activated signal transducers and activators of transcription 3 (STAT3) is required for Fascin upregulation. As an actin-bundling protein, Fascin can mediate gastric cancer (GC) cell migration. Gastric cancer AGS cells were treated with anti-Fas (5 μg/ml) for 2 h
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.