콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU023701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nox4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGGAAGAACCCAAGTTCCAAGCTCATTTCCCACAGACCTGGATTTGGATTTCTGGACCTTTGTGCCTTTATTGTGCGGAGAGACTTTACCGATGCATCAGGAGCAACAAACCTGTCACCATCATCTCAGTCATCAATCATCCCTCTGATGTAATGGAACTCCGTATGATCAAAGAAAACTTTAAAGCAAGACCTGGCCAGTATATTATTCTCCATTGCCCCAGTGTATCAGCATTAGAAAACCACCCATTTACTCTCACAATGTGTCCTACTGAAACCAAAGCAACATTTGGTGTCCACTTTAAAGTAGTAGGAGACTGGACAGAACGATTCCGGGATTTGCTACTGCCTCCATCAAGTCAAGACTCTGAGATTCTGCCCTTCATTCACTCTAGAAATTACCCTAAGTTATACATTGATGGTCCATTTGGAAGCCCATTTGAGGAGTCA

Ensembl | 마우스 수납 번호

ENSMUSG00000030562

NCBI 수납 번호

NM_015760

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... NOX4(50490) , Nox4(50490)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Aleksandr E Vendrov et al.
Antioxidants & redox signaling, 23(18), 1389-1409 (2015-06-10)
Increased oxidative stress and vascular inflammation are implicated in increased cardiovascular disease (CVD) incidence with age. We and others demonstrated that NOX1/2 NADPH oxidase inhibition, by genetic deletion of p47phox, in Apoe(-/-) mice decreases vascular reactive oxygen species (ROS) generation
Motoya Tanaka et al.
Oncology reports, 34(4), 1726-1732 (2015-08-05)
Malignant pleural mesothelioma (MPM) is an aggressive tumor that is characterized by dysregulated growth and resistance to apoptosis. Reactive oxygen species (ROS)-generating NADPH oxidase (Nox) family enzymes have been suggested to be involved in neoplastic proliferation. Both the antioxidant N-acetylcysteine
Jin-Ran Chen et al.
The Journal of biological chemistry, 290(23), 14692-14704 (2015-04-30)
Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor
Qian Jiang et al.
PloS one, 9(9), e107135-e107135 (2014-09-10)
Our previous studies demonstrated that bone morphogenetic protein 4 (BMP4) mediated, elevated expression of canonical transient receptor potential (TRPC) largely accounts for the enhanced proliferation in pulmonary arterial smooth muscle cells (PASMCs). In the present study, we sought to determine
Cheng-Chang Yeh et al.
Clinical oral investigations, 19(6), 1463-1471 (2014-12-04)
Triethylene glycol dimethacrylate (TEGDMA) is a common component of resin-based dental composites and endodontic sealers. TEGDMA induces apoptosis in several types of cells. However, the mechanisms are not completely understood. The aim of this study was to investigate the mechanisms
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.