콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU022451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gata2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGGAACGCCAACGGGGACCCTGTGTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACCCGGAATCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAATGTTTCGAGGAGCTCTCCAAGTGCATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGCCCTGGCTGGACACATGGCACCTGTGGGACACCTCCCACCTTTTAGTCACTCTGGACACATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTTTGGCCACCCCCACCCGTCCAGCATGGTGACTGCCATGGGCTAGGCAAGCCTCCCACTGGACAGACATGGACATCAAGGGTGGT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Song Shen et al.
Molecular pharmaceutics, 11(8), 2612-2622 (2014-02-14)
Synthetic lethal interaction provides a conceptual framework for the development of wiser cancer therapeutics. In this study, we exploited a therapeutic strategy based on the interaction between GATA binding protein 2 (GATA2) downregulation and the KRAS mutation status by delivering
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.