콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU020861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd276

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GACCAGGATGGAGATGGAGAAGGATCCAAGACAGCTCTACGGCCTCTGAAACCCTCTGAAAACAAAGAAGATGACGGACAAGAAATTGCTTGATTGGGAGCTGCTGCCCTTCCCAGGTGGGGGGCCCACCCTCTGGCAGTGTTGAGCTTCAATGCGAGCCCTTCCCCCCAACGAATGGGTTTGTCCCACAGATCTACCCGTTCGTCAAAGGACGTGGTCCATAGACCACCCACAGCCTTACTTTTCCAATGGACTTAATTCCCATCATCCTGCAGCCTCATTTCTCCAGTGACACGATACACGAACCATCCTGCGGCCTTATTTCCCACGGACACGACACAAAGATGTCCCTCCTCGGTGTTCCTCCAGAGTCGTCTGGTGGCCTTGTGATACGGCGTGAACCTTCTTCCTTCTGCCTTACGTCTAATGGACACACACGCACC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Feifei Wang et al.
Cancer investigation, 32(6), 262-271 (2014-05-03)
B7-H3 has been detected in different cancers and correlated to tumor progression and outcome in cancer patients. In this study, we investigated the expression of B7-H3 in tissues and cells of primary hepatocellular carcinoma (PHC) patients. The research showed that
Wei Zhang et al.
OncoTargets and therapy, 8, 1721-1733 (2015-07-24)
The role of B7-H3 in acute monocytic leukemia U937 cells has not been thoroughly investigated. B7-H3 knockdown in the U937 cell line was performed using small hairpin (sh)RNA lentivirus transduction. The effects on cell proliferation, cycle, migration, and invasion were
Fu-Biao Kang et al.
Cancer cell international, 15, 45-45 (2015-04-25)
B7-homologue 3 (B7-H3), a recently identified immunoregulatory protein, has been shown to be overexpressed in human hepatocellular carcinoma (HCC). However, whether the dynamic expression pattern of B7-H3 contributes to early invasion of HCC is largely unknown. In addition, the biological

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.