설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGCTTAGTCTTCCTCATCGCTGTGGTCGTCATTGCCATCGTATGTAACAGACGGGGGTTTGAGCGTGCCGACTCAGAGTACACGGACAAGCTACAACACTACACCAGCGGACACATGACCCCAGGCATGAAGATCTATATAGACCCTTTCACCTATGAAGATCCTAATGAGGCAGTGCGGGAGTTTGCCAAGGAAATTGACATCTCCTGTGTCAAGATTGAGCAGGTGATCGGAGCAGGGGAATTTGGTGAGGTCTGCAGTGGCCATTTGAAGCTGCCAGGCAAGAGAGAGATCTTTGTAGCCATCAAGACCCTCAAGTCAGGATACACGGAGAAACAGCGCCGGGACTTCCTGAGTGAGGCATCCATCATGGGCCAGTTCGACCACCCCAATGTCATCCATCTGGAAGGGGTTGTCACCAAGAGCACACCTGTC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... EPHB2(13844) , Ephb2(13844)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(10), 10031-10041 (2014-07-12)
The activation of Ephrin (Eph) receptors, the largest tyrosine kinase families of cell surface receptor, has recently been addressed in human cholangiocarcinoma (CCA). Therefore, the present study aimed to investigate the role of Eph receptors and its ligands in CCA.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Biochimica et biophysica acta, 1853(8), 1905-1917 (2015-05-13)
The role of unsaturated fatty acids (UFAs) is essential for determining stem cell functions. Eph/Ephrin interactions are important for regulation of stem cell fate and localization within their niche, which is significant for a wide range of stem cell behavior.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.