설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCACGCTCGGGACAAGTGGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACAATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAGGTGGACATTTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAGGAACGACTACGTGCACGCGCTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGCTTCTCCACCAGTCCTGAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... PRMT1(15469) , Prmt1(15469)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the
Dong-Il Kim et al.
Oxidative medicine and cellular longevity, 2015, 617919-617919 (2015-11-20)
Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is involved in the progression of diabetic retinopathy. Arginine methylation catalyzed by protein arginine methyltransferases (PRMTs) has emerged as an important histone modification involved in diverse diseases. Sirtuin (SIRT1) is a protein
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.