콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU015451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hif1a

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCAGCCTAACAGTCCCAGTGAATATTGCTTTGATGTGGATAGCGATATGGTCAATGTATTCAAGTTGGAACTGGTGGAAAAACTGTTTGCTGAAGACACAGAGGCAAAGAATCCATTTTCAACTCAGGACACTGATTTAGATTTGGAGATGCTGGCTCCCTATATCCCAATGGATGATGATTTCCAGTTACGTTCCTTTGATCAGTTGTCACCATTAGAGAGCAATTCTCCAAGCCCTCCAAGTATGAGCACAGTTACTGGGTTCCAGCAGACCCAGTTACAGAAACCTACCATCACTGCCACTGCCACCACAACTGCCACCACTGATGAATCAAAAACAGAGACGAAGGACAATAAAGAAGATATTAAAATACTGATTGCATCTCCATCTTCTACCCAAGTACCTCAAGAAACGACCACTGCTAAGGC

Ensembl | 마우스 수납 번호

ENSMUSG00000021109

NCBI 수납 번호

NM_010431

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... HIF1A(15251) , Hif1a(15251)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Naoki Adachi et al.
Biochemical and biophysical research communications, 463(4), 1176-1183 (2015-06-19)
Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression
Alessia Brossa et al.
Oncotarget, 6(13), 11295-11309 (2015-05-08)
Different mechanisms of angiogenesis and vasculogenesis are involved in the development of the tumor vasculature. Among them, cancer stem cells are known to contribute to tumor vasculogenesis through their direct endothelial differentiation. Here, we investigated the effect of anti-angiogenic therapy
Bejan J Saeedi et al.
Molecular biology of the cell, 26(12), 2252-2262 (2015-04-24)
Intestinal epithelial cells (IECs) are exposed to profound fluctuations in oxygen tension and have evolved adaptive transcriptional responses to a low-oxygen environment. These adaptations are mediated primarily through the hypoxia-inducible factor (HIF) complex. Given the central role of the IEC
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.