콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU014431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bsg

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTCCTGCATCTTCCTTCCTGAGCCTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTCCAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTCTGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATGTGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCACCTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGCATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lipan Peng et al.
Molecular and cellular biochemistry, 405(1-2), 73-79 (2015-04-12)
Chemotherapy remains the core of anticancer treatment. However, despite the tremendous strides made in the development of targeted anticancer therapies, emergence of resistance to chemotherapeutic drugs is still a major obstacle in the successful management of resistant tumors. Therefore, profound
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Eleni Milia-Argeiti et al.
Biochimica et biophysica acta, 1840(8), 2581-2588 (2014-03-13)
Elevated levels of EMMPRIN/CD147 in cancer tissues have been correlated with tumor progression but the regulation of its expression is not yet understood. Here, the regulation of EMMPRIN expression was investigated in testicular germ cell tumor (TGCTs) cell lines. EMMPRIN

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.