콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU013351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fgfr4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAAACACGTCGTCATCAACGGCAGCAGCTTCGGCGCCGACGGTTTCCCCTACGTACAAGTCCTGAAGACAACAGACATCAATATCTCGGAGGTACAGGTCTTGTATCTGAGGAACGTGTCCGCTGAGGATGCAGGAGAGTATACCTGTCTGGCGGGCAACTCCATCGGCCTTTCCTACCAGTCAGCGTGGCTCACGGTGCTGCCAGAGGAAGACCTCACGTGGACAACAGCAACCCCTGAGGCCAGATACACAGATATCATCCTGTATGTATCAGGCTCACTGGTTCTGCTTGTGCTCCTGCTGCTGGCCGGGGTGTATCATCGGCAAGTCATCCGTGGCCACTACTCTCGCCAGCCTGTCACTATACAAAAGCTGTCCCGTTTCCCTTTGGCCCGACAGTTCTCTTTGGAGTCGAGGTCCTCTG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Susagna Padrissa-Altés et al.
Gut, 64(9), 1444-1453 (2014-11-25)
Fibroblast growth factors (Fgfs) are key orchestrators of development, and a role of Fgfs in tissue repair is emerging. Here we studied the consequences of inducible loss of Fgf receptor (Fgfr) 4, the major Fgf receptor (Fgfr) on hepatocytes, alone
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Shuxin Han et al.
Nature communications, 6, 7231-7231 (2015-06-05)
Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.