추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATACCACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGCAATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATACAAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCTTCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGAGTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAGTCCTTCCTACCCCAATTTCC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... IL6(16193) , Il6(16193)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yong Xia et al.
Molecular and cellular biochemistry, 398(1-2), 147-156 (2014-09-23)
Piperine, a kind of natural alkaloid found in peppers, has been reported to exhibit anti-oxidative and anti-tumor activities, both in vitro and in vivo. Interleukin-6 (IL-6) is an important cytokine that activates the signal transduction, promotes tumor cell metastasis, and
Victoria Ingham et al.
Journal of neuroinflammation, 11, 115-115 (2014-06-24)
Activated microglia are associated with deposits of aggregated proteins within the brains of patients with Alzheimer's disease (AD), Parkinson's disease (PD) and prion diseases. Since the cytokines secreted from activated microglia are thought to contribute to the pathogenesis of these
Shijia Zhang et al.
Stem cells (Dayton, Ohio), 32(6), 1616-1628 (2014-01-23)
Adipose-derived stromal/stem cells (ASCs) have anti-inflammatory as well as immunosuppressive activities and are currently the focus of clinical trials for a number of inflammatory diseases. Acute lung injury (ALI) is an inflammatory condition of the lung for which standard treatment
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.