설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGGCTCCAGACATTTACCCAGTTTACAGGCTGGAGATTGATCTGTTCAAGGGTGACCAGCTCATGAACAGACAGGAGTTTTCTTCAGAAGAGATGACAAAGTCTCTAGAAACCAAGAGTTTGGAAGTAACCTTTACTCCCGTCATTGAGGATATTGGAAAAGCTCTTGTTTGCCGAGCTAAATTACACATTGACCAAATTGATTCTACACTCAAAGAAAGGGAGACTGTCAAAGAACTACAAGTCTACATCTCTCCCAGGAATACAACGATCTCTGTACATCCCTCCACAAGGCTTCAAGAGGGTGGTGCTGTGACAATGACCTGTTCCAGCGAGGGTCTACCAGCTCCTGAGATTTTCTGGGGCAGGAAGTTAGATAATGAAGTTCTCCAGCTTCTCTCAGGAAATGCCATCCTC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... VCAM1(22329) , Vcam1(22329)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Julie Belliere et al.
Theranostics, 5(11), 1187-1202 (2015-09-18)
Endothelial activation is a hallmark of cardiovascular diseases, acting either as a cause or a consequence of organ injury. To date, we lack suitable methods to measure endothelial activation in vivo. In the present study, we developed a magnetic resonance
Gareth W Fearnley et al.
Molecular biology of the cell, 25(16), 2509-2521 (2014-06-27)
Vascular endothelial growth factor A (VEGF-A) regulates many aspects of vascular physiology. VEGF-A stimulates signal transduction pathways that modulate endothelial outputs such as cell migration, proliferation, tubulogenesis, and cell-cell interactions. Multiple VEGF-A isoforms exist, but the biological significance of this
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.