설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCAAGCAGTGCACAGATAAGCGGATTAGAACCAATCTCTTACAGGTATGCGAGCGAATCCCAACTATAAGCACCCAGCTCAAAATCCTATCCACAGTGAAGGCCACTATGCTGGGCCGGACCAACATCAGTGATGAGGAGTCTGAGCAGGCCACAGAGATGCTGGTTCATAATGCCCAGAACCTCATGCAGTCTGTGAAGGAGACTGTGCGAGAGGCTGAAGCTGCTTCAATCAAAATCCGAACAGATGCTGGCTTTACTCTGCGCTGGGTCAGAAAGACTCCCTGGTACCAGTAGGCACCTCGTCAAATCTGGCTGGTACATACACCTCTGCTAAAGAGAAGGGAACCATCTTGAGTTCCAGAAGCCATTCAGAGTTGTCAGGAATGGAAACATCAATCCCTGGCTTCAC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... VCL(22330) , Vcl(22330)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ryuichi Fukuda et al.
Developmental cell, 51(1), 62-77 (2019-09-10)
Mechanical forces regulate cell behavior and tissue morphogenesis. During cardiac development, mechanical stimuli from the heartbeat are required for cardiomyocyte maturation, but the underlying molecular mechanisms remain unclear. Here, we first show that the forces of the contracting heart regulate
Matthew G Rubashkin et al.
Cancer research, 74(17), 4597-4611 (2014-09-04)
Extracellular matrix (ECM) stiffness induces focal adhesion assembly to drive malignant transformation and tumor metastasis. Nevertheless, how force alters focal adhesions to promote tumor progression remains unclear. Here, we explored the role of the focal adhesion protein vinculin, a force-activated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.