콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU000411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA

Ensembl | 마우스 수납 번호

ENSMUSG00000020063

NCBI 수납 번호

NP_062786

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... SIRT1(93759) , Sirt1(93759)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie-Ning Zhu et al.
Scientific reports, 7(1), 11879-11879 (2017-09-21)
The molecular mechanisms underlying anthracyclines-induced cardiotoxicity have not been well elucidated. MiRNAs were revealed dysregulated in the myocardium and plasma of rats received Dox treatment. MicroRNA-34a-5p (miR-34a-5p) was verified increased in the myocardium and plasma of Dox-treated rats, but was
Hisae Yoshitomi et al.
PloS one, 12(8), e0183988-e0183988 (2017-09-01)
Diabetes is caused by the lack of release or action of insulin. Some foods and supplements can compensate for this deficiency; thus, they can aid in the prevention or treatment of diabetes. The aim of this study was to investigate
Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Huei-Yu Chen et al.
Oncotarget, 8(9), 15338-15348 (2017-01-26)
Oxaliplatin belongs to the platinum-based drug family and has shown promise in cancer treatment. The major mechanism of action of platinum compounds is to form platinum-DNA adducts, leading to DNA damage and apoptosis. Accumulating evidence suggests that they might also
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.