설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTCCACCAGTCACCACACCAACGACTGCACAGATACGTGGAGCTTGCCTGGGGCTTCTCTACTGCCTTGGGTACCTTTCTCTTCCTGGCTGAAGTTGTTCTGGTGGGCTGGGTCAAGTTTGTGCCCATTGGGGCACCCATGGGTAAACCAGCTCCTGTTGTACCTATGTCCCAGGTGCCACCTGTGACTGTCTCCCTTAGTTTAGCTTCTAACCTCACACCATCCTCTGCTTCTATTACCACATCACAACAGCCTTCCAAAGCCTGTCCACCCCGGCAAGTGTGTGATAGTGCTCATGGACCAGGCTGGCAGGCAGCTATGGCCTCCACGGCAATCATGGTACCTGTGGGACTAGTGTTTATGGCCTTTGCCCTACATTTCTACCGATCCTTGGTTGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... ORAI3(269999) , Orai3(269999)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.