설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGGAGAACGAGCTCACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAATGGCGGCCTGGCCTAGACCAGGGGTGCAGCCAGCTTTTGGAGAACCTGGATGGCCTTAGGGTTCCTTCTGCGGCTATTGCTGAACCCCTGTCCATCCACGGGACCCTGAAACTCCACTTGGCCTATCTGCTGGACCTGCTGGGGCAGAGTTGATTGCCTTCCCCAGGAGCCAGACCACTGGGGGTGCATCATTGGGGATTCTGCCTCAGGTACTTTGATAGAGTGTGGGGTGGGGGGGACCTGCTTTGGAGATCAGCCTCACCTTCTCCCATCCCAGAAGCGGGGCTTACAGCCAGCCCTTACAGTTTCACTCATGAAGCACCTTGATCTTTGGTGTCCTGGACTTCATCCTGGGTGCTGCAGATAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRADD(8717) , TRADD(8717)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Hua Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1063-1078 (2016-12-14)
Chronic lung infection in cystic fibrosis leads to an inflammatory response that persists because of the chronic presence of bacteria and ultimately leads to a catastrophic failure of lung function. We use a combination of biochemistry, cell and molecular biology
Ganqian Zhu et al.
Journal of immunology (Baltimore, Md. : 1950), 198(3), 1104-1118 (2017-01-01)
The apoptosis of glomerular mesangial cells (GMCs) in the early phase of rat Thy-1 nephritis (Thy-1N), a model of human mesangioproliferative glomerulonephritis (MsPGN), is primarily triggered by sublytic C5b-9. However, the mechanism of GMC apoptosis induced by sublytic C5b-9 remains
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.