콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU157951

Sigma-Aldrich

MISSION® esiRNA

targeting human DSC2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAAACCCACCATGTCATCTGCGGAGATTGTTGCGGTTGATCCTGATGAGCCTATCCATGGCCCACCCTTTGACTTTAGTCTGGAGAGTTCTACTTCAGAAGTACAGAGAATGTGGAGACTGAAAGCAATTAATGATACAGCAGCACGTCTTTCCTATCAGAATGATCCTCCATTTGGCTCATATGTAGTACCTATAACAGTGAGAGATAGACTTGGCATGTCTAGTGTCACTTCATTGGATGTTACACTGTGTGACTGCATTACCGAAAATGACTGCACACATCGTGTAGATCCAAGGATTGGCGGTGGAGGAGTACAACTTGGAAAGTGGGCCATCCTTGCAATATTGTTGGGCATAGCATTGCTCTTTTGCATCCTGTTTACGCTGGTCTGTGGGGCTTCTGGGACGTCTAAACAACCAAAAGTAATTCCTGATGATTTAGCCCAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Svitlana Kurinna et al.
Nature communications, 5, 5099-5099 (2014-10-07)
The Nrf2 transcription factor controls the expression of genes involved in the antioxidant defense system. Here, we identified Nrf2 as a novel regulator of desmosomes in the epidermis through the regulation of microRNAs. On Nrf2 activation, expression of miR-29a and
Keli Kolegraff et al.
Molecular biology of the cell, 22(8), 1121-1134 (2011-02-18)
Desmocollin-2 (Dsc2) and desmoglein-2 (Dsg2) are transmembrane cell adhesion proteins of desmosomes. Reduced expression of Dsc2 has been reported in colorectal carcinomas, suggesting that Dsc2 may play a role in the development and/or progression of colorectal cancer. However, no studies

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.