콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU157721

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB25

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sehime Gulsun Temel et al.
Apoptosis : an international journal on programmed cell death, 25(11-12), 799-816 (2020-09-10)
Ovarian cancer remains one of the most frequent causes of cancer-related death in women. Many patients with ovarian cancer suffer from de novo or acquired resistance to chemotherapy. Here, we report that RAB25 suppresses chemotherapy-induced mitochondrial apoptosis signaling in ovarian
Moorthy Krishnan et al.
Molecular biology of the cell, 24(6), 818-831 (2013-01-25)
Rab25 is a tumor suppressor for colon cancer in humans and mice. To identify elements of intestinal polarity regulated by Rab25, we developed Caco2-BBE cell lines stably expressing short hairpin RNA for Rab25 and lines rescuing Rab25 knockdown with reexpression
Ukhyun Jo et al.
Oncotarget, 5(5), 1265-1278 (2014-03-25)
Oncogenic alterations of epidermal growth factor receptor (EGFR) signaling are frequently observed in lung cancer patients with worse differentiation and poor prognosis. However, the therapeutic efficacy of EGFR-tyrosine kinase inhibitors (TKIs) is currently limited in selected patients with EGFR mutations.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.