콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU157231

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACCTTCATGGACGGCTACACAGGAGAGTTTGACACCTTCCTCTACCAGCTGCCAGGAACAGTCCAGCCATGCTCCTCAGCCTCCTCCTCGGCCTCCTCCACATCCTCGTCCTCAGCCACCTCCCCTGCCTCTGCCTCCTTCAAGTTCGAGGACTTCCAGGTGTACGGCTGCTACCCCGGCCCCCTGAGCGGCCCAGTGGATGAGGCCCTGTCCTCCAGTGGCTCTGACTACTATGGCAGCCCCTGCTCGGCCCCGTCGCCCTCCACGCCCAGCTTCCAGCCGCCCCAGCTCTCTCCCTGGGATGGCTCCTTCGGCCACTTCTCGCCCAGCCAGACTTACGAAGGCCTGCGGGCATGGACAGAGCAGCTGCCCAAAGCCTCTGGGCCCCCACAGCCTCCAGCCTTCTTTTCCTTCA

Ensembl | 인체 수납 번호

ENSG00000123358

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NR4A1(3164) , NR4A1(3164)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hiroki Maruoka et al.
Scientific reports, 10(1), 6325-6325 (2020-04-15)
Forskolin promotes neuronal differentiation of PC12 cells via the PKA-CREB-dependent signaling pathway. Activation of PKA by forskolin phosphorylates CREB, which then binds to CRE sites in numerous gene promoters. However, it is unclear which gene contains the CRE sites responsible
Meihui Huang et al.
Journal of Cancer, 10(15), 3560-3570 (2019-07-12)
NR4A1 acts as an oncogene and plays an important role in colorectal cancer development and progression, but little is known about the regulatory mechanism of NR4A1 expression. MicroRNA (miRNA) is involved in the progression of various tumors, affecting proliferation, apoptosis
Bin Huang et al.
Scientific reports, 8(1), 13895-13895 (2018-09-19)
Nur77 is a member of the NR4A subfamily of nuclear receptors and has been shown to regulate various biological processes such as apoptosis and inflammation. Here, we show that Nur77 ubiquitination is mediated by the tripartite motif 13 (Trim13), a
Mei Ha et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(6), 2029-2045 (2018-11-12)
Triclosan (TCS), a broad-spectrum antibacterial and antifungal compound and an endocrine disruptor, has anti-androgenic properties and could adversely affect male reproduction and fertility. To elucidate the underlying roles of miRNAs and the MAPK pathway in TCS-mediated repression of testicular steroidogenesis
Xina Xie et al.
Clinical science (London, England : 1979), 129(12), 1151-1161 (2015-09-24)
Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.