콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU156431

Sigma-Aldrich

MISSION® esiRNA

targeting human TIMP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAAC

Ensembl | 인체 수납 번호

ENSG00000102265

NCBI 수납 번호

NM_003254

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TIMP1(7076) , TIMP1(7076)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
HFT

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Omar M Omar et al.
Molecular carcinogenesis, 57(11), 1577-1587 (2018-07-24)
Tissue inhibitor matrix metalloproteinase-1 (TIMP1) is one of four identified members of the TIMP family. We evaluated the role of TIMP1 in gastric cancer using human and mouse tissues along with gastric organoids and in vitro cell models. Using quantitative
Fenglin Zhao et al.
International journal of molecular medicine, 44(5), 1609-1618 (2019-09-06)
Parastomal hernia (PH) is a common complication following stoma formation. Abnormal collagen synthesis has been suggested to be involved in PH. The aim of the present study is to explore the effect and mechanism of the collagen synthesis on PH.
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Robert Ramer et al.
Biochemical pharmacology, 91(2), 202-216 (2014-07-01)
Cannabinoids inhibit tumor neovascularization as part of their tumorregressive action. However, the underlying mechanism is still under debate. In the present study the impact of cannabinoids on potential tumor-to-endothelial cell communication conferring anti-angiogenesis was studied. Cellular behavior of human umbilical

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.