설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGGTGTTCAAGGACCATCCCCAGGGCACAGAACCTGATATGTACAAATATGATGCCTATTTGTGCTTCAGCAGCAAAGACTTCACATGGGTGCAGAATGCTTTGCTCAAACACCTGGACACTCAATACAGTGACCAAAACAGATTCAACCTGTGCTTTGAAGAAAGAGACTTTGTCCCAGGAGAAAACCGCATTGCCAATATCCAGGATGCCATCTGGAACAGTAGAAAGATCGTTTGTCTTGTGAGCAGACACTTCCTTAGAGATGGCTGGTGCCTTGAAGCCTTCAGTTATGCCCAGGGCAGGTGCTTATCTGACCTTAACAGTGCTCTCATCATGGTGGTGGTTGGGTCCTTGTCCCAGTACCAGTTGATGAAACATCAATCCATCAGAGGCTTTGTACAGAAACAGCAGTATTTGAGGTGGCCTGAGGATTTCCAGGATGTTGGCTGGTTTCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TLR5(7100) , TLR5(7100)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Li-Juan Ji et al.
Journal of cellular biochemistry, 119(1), 1017-1026 (2017-07-08)
MicroRNAs (miRNAs) are reported as vital participators in the pathophysiological course of neuropathic pain. However, the underlying mechanisms of the functional roles of miRNAs in neuropathic pain are largely unknown. This study was designed to explore the potential role of
Signaling Mediated by Toll-
Maria Del Mar Cendra et al.
Frontiers in cellular and infection microbiology, 7, 130-130 (2017-05-05)
Tanay Bhatt et al.
Cell reports, 29(9), 2546-2555 (2019-11-28)
Antimicrobial peptides (AMPs) are the body's natural innate immune defense against a spectrum of pathogens and can also modulate cell proliferation, chemotaxis, angiogenesis, wound healing, and immune cell activity. Harnessing these diverse functions for prophylactic use is contingent upon understanding
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.