설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCCTCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGCACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCTCATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCACTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCGCCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTACCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FOXA1(3169) , FOXA1(3169)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Shixiong Wang et al.
International journal of molecular sciences, 19(12) (2018-12-24)
Forkhead box A1 (FOXA1) belongs to the forkhead class transcription factor family, playing pioneering function for hormone receptors in breast and prostate cancers, and mediating activation of linage specific enhancers. Interplay between FOXA1 and breast cancer specific signaling pathways has
Shijun Lu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 69(7), 645-656 (2020-04-29)
Nowadays, sepsis-induced acute kidney injury (AKI) has gradually become a global problem for its high incidence and increasing mortality. Previous study has reported lncRNA ENST00000452391.1 in sepsis patients. However, its potential biological function and downstream molecular mechanism are still mysterious.
Shannon Whirledge et al.
Endocrinology, 158(11), 4076-4092 (2017-09-25)
Successful pregnancy relies on dynamic control of cell signaling to achieve uterine receptivity and the necessary biological changes required for endometrial decidualization, embryo implantation, and fetal development. Glucocorticoids are master regulators of intracellular signaling and can directly regulate embryo implantation
Erina Anzai et al.
Biological & pharmaceutical bulletin, 40(9), 1483-1489 (2017-09-05)
Epithelial-to-mesenchymal transition (EMT) is an important process during embryonic development and tumor progression by which adherent epithelial cells acquire mesenchymal properties. Forkhead box protein A1 (FOXA1) is a transcriptional regulator preferentially expressed in epithelial breast cancer cells, and its expression
Suzie K Hight et al.
Neoplasia (New York, N.Y.), 22(8), 294-310 (2020-06-09)
Using a mini-library of 1062 lentiviral shRNAs targeting 40 nuclear hormone receptors and 70 of their co-regulators, we searched for potential therapeutic targets that would be important during in vivo tumor growth using a parallel in vitro and in vivo
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.