설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTCATTCTGCTGGCTCTCTGCGCCCTTGTTGCCACCATCTGGTTCCCTGTGTGCGCCCACCGTGAGACCACCATCGTGAGCTTTGGCTACTCCCTGTATGCAGGCTGGATTGGTGCTGTGCTGTGCCTCGTGGGTGGCTGTGTCATCCTCTGCTGCGCTGGAGATGCCCAGGCCTTTGGTGAAAACCGTTTCTACTACACTGCGGGCTCTAGCTCCCCGACTCATGCGAAGAGTGCCCACGTATAAGAGGGCTGCCCGGCTGCCCACAGAGGTGCTGTAGATGCTGGGCCCAGGGCCCTAGGTTTGCTCGTCACAGTGTGGGGAAGCCCATTCCTCTGCCAGGCTCTAAAGCCAAAGGTCTAGAAAAGCATCCTGTCTGGCATTTTGTAGTCTTAACTTCTCCCCATTTCCCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CLDN11(5010) , CLDN11(5010)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Nami O Yamada et al.
International journal of molecular sciences, 20(18) (2019-09-11)
Extracellular vesicles (EVs) are nanometer-sized membranous vesicles used for primitive cell-to-cell communication. We previously reported that colon cancer-derived EVs contain abundant miR-92a-3p and have a pro-angiogenic function. We previously identified Dickkopf-3 (Dkk-3) as a direct target of miR-92a-3p; however, the
Impaired Localization of Claudin-11 in Endometriotic Epithelial Cells Compared to Endometrial Cells.
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.