콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU154181

Sigma-Aldrich

MISSION® esiRNA

targeting human NOL3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGGGACGAGTCCGAAGATTCCTGAAGGCCAGAGCTCTGACAGGCGGTGCCCCGCCCATGCTGGATAGGACCTGGGATGCTGCTGGAGCTGAATCGGATGCCACCAAGGCTCGGTCCAGCCCAGTACCGCTGGAAGTGAATAAACTCCGGAGGGTCGGACGGGACCTGGGCTCTCTCCACGATTCTGGCTGTTTGCCCAGGAACTTAGGGTGGGTACCTCTGAGTCCCAGGGACCTGGGCAGGCCCAAGCCCACCACGAGCATCATCCAGTCCTCAGCCCTAATCTGCCCTTAGGAGTCCAGGCTGCACCCTGGAGATCCCAAACCTAGCCCCCTAGTGGGACAAGGACCTGACCCTCCTGCCCGCATACACAACCCATTTCCCCTGGTGAGCCACTTGGCAGCATATGTAGGTACCAGCTCAACCCCACGCAAGTTCCTGAGCTGAACATGGAGCAAGGGGAGGGTGACTTCTCTCCACATAGGGAGGGCTTAGAGCTCACAGCCTTGGGAAGTGAGACTAGAAGAGGGGAGCAGAAAGG

Ensembl | 인체 수납 번호

ENSG00000140939

NCBI 수납 번호

NM_003946

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NOL3(8996) , NOL3(8996)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Csaba Toth et al.
Cell communication and signaling : CCS, 15(1), 16-16 (2017-05-04)
Renal cell carcinomas (RCCs) display broad resistance against conventional radio- and chemotherapies, which is due at least in part to impairments in both extrinsic and intrinsic apoptotic pathways. One important anti-apoptotic factor that is strongly overexpressed in RCCs and known
Fang Xie et al.
Acta physiologica (Oxford, England), 228(2), e13337-e13337 (2019-07-02)
Cardiac hypertrophy and myocardial apoptosis are two major factors in heart failure. As a classical regulator of apoptosis, apoptosis repressor with caspase recruitment domain (ARC) has recently also been found to have a protective effect against hypertrophy. However, the mechanism
Christopher DeBoever et al.
Nature communications, 9(1), 1612-1612 (2018-04-25)
Protein-truncating variants can have profound effects on gene function and are critical for clinical genome interpretation and generating therapeutic hypotheses, but their relevance to medical phenotypes has not been systematically assessed. Here, we characterize the effect of 18,228 protein-truncating variants
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.