설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATTCTGGTGGACCTGGAACCCGGAACCATGGACAGTGTCCGCTCAGGGGCCTTTGGACATCTCTTCAGGCCTGACAATTTCATCTTTGGTCAGAGTGGGGCCGGCAACAACTGGGCCAAGGGTCACTACACGGAGGGGGCGGAGCTGGTGGATTCGGTCCTGGATGTGGTGCGGAAGGAGTGTGAAAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGGGGCGGCACGGGCTCCGGCATGGGCACGTTGCTCATCAGCAAGGTGCGTGAGGAGTATCCCGACCGCATCATGAACACCTTCAGCGTCGTGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACGCTGTCCATCCACCAGCTGGTGGAGAACACGGATGAGACCTACTGCATCGACAACGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TUBB3(10381) , TUBB3(10381)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sidika Öztop et al.
Anticancer research, 39(2), 655-662 (2019-02-04)
The challenges of cololorectal cancer (CRC) management include prediction of outcome and drug response or chemoresistance. This study aimed at examining whether βIII-tubulin (TUBB3), present in various types of normal tissues and cancer, is a biomarker for the response of
Yohei Sekino et al.
Oncology, 98(10), 689-698 (2020-06-26)
βIII-Tubulin, encoded by the TUBB3 gene, is a microtubule protein. Several studies have shown that overexpression of TUBB3 is linked to poor prognosis and is involved in taxane resistance in some cancers. The aim of this study was to analyze
Mihoko A Tame et al.
Oncotarget, 8(42), 71536-71547 (2017-10-27)
Microtubules are cellular targets for a variety of anticancer therapies because of their critical function in mitosis. Taxol belongs to a class of microtubule targeting agents that suppresses microtubule dynamics and interferes with the functioning of the mitotic spindle, thereby
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.