설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTGGAGACAAGAGCTGGAGACTGGAGGTTTCTAACCAGCATCCAGAAGGTTCGTTAGCCAGGTGGTCCCTTCTACAATCGAGCAGCTCCTTGGACAGACTGTTTCTCAGTTATTTCCAGAGACCCAGCTACAGTTCCCTGGCTGTTTCTAGAGACCCAGCTTTATTCACCTGACTGTTTCCAGAGACCCAGCTAAAGTCACCTGCCTGTTCTAAAGGCCCAGCTACAGCCAATCAGCCGATTTCCTGAGCAGTGATGCCACCTCCAAGCTTGTCCTAGGTGTCTGCTGTGAACCTCCAGTGACCCCAGAGACTTTGCTGTAATTATCTGCCCTGCTGACCCTAAAGACCTTCCTAGAAGTCAAGAGCTAGCCTTGAGACTGTGCTATACACACACAGCTGAGAGCCAAGCCCAGTTCTCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LAIR1(3903) , LAIR1(3903)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ying Zhang et al.
Microbial pathogenesis, 109, 292-299 (2017-06-20)
Helicobacter pylori is a Gram-negative, microaerophilic bacteria usually found in the stomach, which may evade its host's immune system and present long-term symptoms in affected individuals. This study aimed to evaluate the functional role of leukocyte-associated immunoglobulin (Ig)-like receptor-1 (LAIR-1)
Guofeng Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1050-1059 (2019-03-08)
Vascular remodeling is a critical event following a stroke. It is a well known fact that C1q is the first molecule in the complement classical pathway. However, its role in the neovascularization that ocurs after a stroke, remains unclear. In
Chitra Joseph et al.
Cancers, 13(1) (2021-01-06)
The leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) plays a role in immune response homeostasis, extracellular matrix remodelling and it is overexpressed in many high-grade cancers. This study aimed to elucidate the biological and prognostic role of LAIR-1 in invasive breast cancer (BC).
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.