콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU152641

Sigma-Aldrich

MISSION® esiRNA

targeting human LAIR1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCTGGAGACAAGAGCTGGAGACTGGAGGTTTCTAACCAGCATCCAGAAGGTTCGTTAGCCAGGTGGTCCCTTCTACAATCGAGCAGCTCCTTGGACAGACTGTTTCTCAGTTATTTCCAGAGACCCAGCTACAGTTCCCTGGCTGTTTCTAGAGACCCAGCTTTATTCACCTGACTGTTTCCAGAGACCCAGCTAAAGTCACCTGCCTGTTCTAAAGGCCCAGCTACAGCCAATCAGCCGATTTCCTGAGCAGTGATGCCACCTCCAAGCTTGTCCTAGGTGTCTGCTGTGAACCTCCAGTGACCCCAGAGACTTTGCTGTAATTATCTGCCCTGCTGACCCTAAAGACCTTCCTAGAAGTCAAGAGCTAGCCTTGAGACTGTGCTATACACACACAGCTGAGAGCCAAGCCCAGTTCTCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ying Zhang et al.
Microbial pathogenesis, 109, 292-299 (2017-06-20)
Helicobacter pylori is a Gram-negative, microaerophilic bacteria usually found in the stomach, which may evade its host's immune system and present long-term symptoms in affected individuals. This study aimed to evaluate the functional role of leukocyte-associated immunoglobulin (Ig)-like receptor-1 (LAIR-1)
Guofeng Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1050-1059 (2019-03-08)
Vascular remodeling is a critical event following a stroke. It is a well known fact that  C1q is the first molecule in the complement classical pathway. However, its role in the neovascularization that ocurs after a stroke, remains unclear. In
Chitra Joseph et al.
Cancers, 13(1) (2021-01-06)
The leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) plays a role in immune response homeostasis, extracellular matrix remodelling and it is overexpressed in many high-grade cancers. This study aimed to elucidate the biological and prognostic role of LAIR-1 in invasive breast cancer (BC).

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.