콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU152211

Sigma-Aldrich

MISSION® esiRNA

targeting human SHARPIN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCAGTGCTCTTGGCTGTGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTGAGCGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAATTTGGAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCACCAGGAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTAGTCCGAGGTGCC

Ensembl | 인체 수납 번호

ENSG00000179526

NCBI 수납 번호

NM_030974

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SHARPIN(81858) , SHARPIN(81858)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dhanya Krishnan et al.
Neurobiology of aging, 93, 131-141 (2020-03-14)
Defective immune cell-mediated clearance of amyloid-beta (Aβ) and Aβ-associated inflammatory activation of immune cells are key contributors in pathogenesis of Alzheimer's disease (AD). However, the underlying mechanisms remain elusive. Shank-associated RH domain-interacting protein (SHARPIN) is a critical regulator of inflammatory
Emilia Peuhu et al.
The EMBO journal, 36(2), 165-182 (2016-12-16)
SHARPIN is a widely expressed multifunctional protein implicated in cancer, inflammation, linear ubiquitination and integrin activity inhibition; however, its contribution to epithelial homeostasis remains poorly understood. Here, we examined the role of SHARPIN in mammary gland development, a process strongly
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.