콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU151901

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | 인체 수납 번호

ENSG00000148516

NCBI 수납 번호

NM_001128128

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ZEB1(6935) , ZEB1(6935)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
NAV
UZU
DRU
ZQU
EQU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jin Xu et al.
Oncology letters, 14(2), 2483-2490 (2017-08-07)
Numerous studies have demonstrated that microRNAs (miRs) are involved in several physiological and pathological processes, and participate in cancer initiation and progression. The abnormal expression of miR-150 has been reported in numerous types of human cancer. However, at present there
Xiao-Jing Chen et al.
Cell death & disease, 10(7), 508-508 (2019-07-03)
The accumulation of tumour-associated macrophages (TAMs) in the hypoxic tumour microenvironment (TME) is associated with malignant progression in cancer. However, the mechanisms by which the hypoxic TME facilitates TAM infiltration are not fully understood. This study showed that high ZEB1
Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Qiongyan Zou et al.
Journal of cellular biochemistry, 119(2), 2189-2199 (2017-09-01)
Breast cancer (BC) is one of the leading causes of cancer deaths worldwide and the most common cancer among women. In our previous study, we revealed that lncRNA TP73-AS1 promotes breast cancer cell proliferation through directly binding to miR-200a. Herein
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.