콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU151571

Sigma-Aldrich

MISSION® esiRNA

targeting human TWIST1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATGCCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGGGCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGCGGCACCATCCTCACACCTCTGCATTCTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

W Liu et al.
European review for medical and pharmacological sciences, 21(17), 3787-3793 (2017-10-05)
Endometrial carcinoma is the most common malignancy of the female genital tract. Therefore, there is an urgent need to understand the molecular mechanism of its metastasis. This study is aimed to explore the function and underlying mechanism of miR-326 in
Wei Li et al.
Oncology reports, 37(1), 185-192 (2016-11-24)
High expression of high mobility group protein A2 (HMGA2) is correlated with the invasiveness of gastric cancer and is an independent prognostic factor. The reason may be that HMGA2 promotes epithelial-mesenchymal transition (EMT) and the acquisition of tumor stem cell properties, yet
Yutian Wang et al.
Frontiers in microbiology, 11, 1301-1301 (2020-07-01)
Staphylococcus aureus (S. aureus) infection-induced osteomyelitis is a great challenge in clinic treatment. Identification of the essential genes and biological processes that are specifically changed in mononuclear cells at an early stage of S. aureus osteomyelitis is of great clinical
Mairéad A Cleary et al.
Stem cells and development, 26(10), 751-761 (2017-03-17)
Human bone marrow-derived mesenchymal stem cells (BMSCs) are clinically promising to repair damaged articular cartilage. This study investigated TWIST1, an important transcriptional regulator in mesenchymal lineages, in BMSC chondrogenesis. We hypothesized that downregulation of TWIST1 expression is required for in
Cai M Roberts et al.
Scientific reports, 6, 37652-37652 (2016-11-24)
Epithelial ovarian cancer (EOC) is the most deadly gynaecologic malignancy due to late onset of symptoms and propensity towards drug resistance. Epithelial-mesenchymal transition (EMT) has been linked to the development of chemoresistance in other cancers, yet little is known regarding

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.