콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU151371

Sigma-Aldrich

MISSION® esiRNA

targeting human MDK

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCTGCAACTGGAAGAAGGAGTTTGGAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCGTGTGATGGGGGCACAGGCACCAAAGTCCGCCAAGGCACCCTGAAGAAGGCGCGCTACAATGCTCAGTGCCAGGAGACCATCCGCGTCACCAAGCCCTGCACCCCCAAGACCAAAGCAAAGGCCAAAGCCAAGAAAGGGAAGGGAAAGGACTAGACGCCAAGCCTGGATGCCAAGGAGCCCCTGGTGTCACATGGGGCCTGGCCCACGCCCTCCCTCTCCCAGGCCCGAGATGTGACCCACCAGTGCCTTCTGTCTGCTCGTTAGCTTTAATCAATCATGCCCTGCCTTGTCCCTCTCACTCCCCAGCCCCACCCCTAAGTGCCCAAAGTGGGGAGGGACAAGGGATTCTGGGAAGCT

Ensembl | 인체 수납 번호

ENSG00000110492

NCBI 수납 번호

NM_001012333

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MDK(4192) , MDK(4192)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Juan Lu et al.
Journal of experimental & clinical cancer research : CR, 37(1), 147-147 (2018-07-14)
Exosomes are small vesicles containing a wide range of functional proteins, mRNA and miRNA. Exosomal miRNAs from cancer cells play crucial roles in mediating cell-cell communication and tumor-microenvironment cross talk, specifically in enabling metastasis and promoting angiogenesis. We focused on
Bin Sun et al.
Oncotarget, 8(20), 32523-32535 (2017-04-22)
Midkine is overexpressed in hepatocellular carcinoma (HCC) and plays a role in tumor progression, but less is known about its role in resistance of circulating tumor cells (CTCs) to anoikis which leading to recurrence and metastasis. The aim of the
Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.