콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU149061

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM8

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTTGAAGCAGGACATCAGCATCCCCGACTACTGCAGCCTGGGCGATGGGGAGGAGGAGGAAATCACCATCAATGCCTGGTTTGGTCCCCAGGGAACCATCTCCCCACTACATCAGGATCCCCAGCAAAACTTCCTAGTGCAGGTGATGGGGAGGAAGTACATCCGGCTGTATTCCCCGCAGGAGTCAGGGGCTCTGTACCCTCATGACACGCACCTTCTCCATAACACGAGCCAGGTTGACGTGGAGAATCCCGACCTGGAAAAGTTCCCCAAGTTTGCCAAGGCCCCATTCCTGTCCTGCATCCTGTCTCCTGGAGAGATCCTGTTCATCCCGGTGAAATACTGGCATTACGTGCGGGCTCTGGATTTGAGCTTCTCGGTCAGCTTCTGGTGGTCGTAGCCAGGATAGGAGCTGAAAGGGCCT

Ensembl | 인체 수납 번호

ENSG00000155666

NCBI 수납 번호

NM_001145348

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KDM8(79831) , JMJD5(79831)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

생화학적/생리학적 작용

JMJD5 (jumonji domain-containing protein 5) exhibits histone H3 lysine 36 dimethylation (H3K36me2) demethylase activity and thereby is associated with gene transcription regulation. In addition, it also has hydroxylase activity and controls osteoclastogenesis. It is linked with cell cycle progression in breast cancer cells, chromosome segregation with the help of RCCD1 (RCC1 domain-containing protein 1), metabolism by controlling PKM2 (pyruvate kinase muscle isozyme) nuclear translocation, microtubule stability and mitotic progression. It also participates in HBV (Hepatitis B virus) replication.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

JMJD5 (Jumonji Domain-containing 5) Associates with Spindle Microtubules and Is Required for Proper Mitosis.
He Z
The Journal of Biological Chemistry, 291, 4684-4684 (2016)
Takahisa Kouwaki et al.
Journal of virology, 90(7), 3530-3542 (2016-01-23)
Hepatitis B virus (HBV) is a causative agent for chronic liver diseases such as hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). HBx protein encoded by the HBV genome plays crucial roles not only in pathogenesis but also in replication of HBV.
Ru Zhang et al.
International journal of clinical and experimental pathology, 8(6), 6482-6489 (2015-08-12)
To observe the effects of Jumonji C domain-containing (JMJD) 5 depletion on colon cancer (CC). A short-hairpin RNA targeting JMJD5 was transfected into a lentivirus to make Lv-shJMJD5 for infection into the Caco-2 human cell. Besides, a negative control shRNA
Jing Shen et al.
EMBO reports, 18(12), 2131-2143 (2017-10-07)
The histone H3 N-terminal protein domain (N-tail) is regulated by multiple posttranslational modifications, including methylation, acetylation, phosphorylation, and by proteolytic cleavage. However, the mechanism underlying H3 N-tail proteolytic cleavage is largely elusive. Here, we report that JMJD5, a Jumonji C

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.