설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGCAAGTACTGGCTGAATGACGACTGGTACCTGAAGTACATCACGCTGAAGACGCCCCACGGGGACTACATCGAGTTCCCCTGCTACCGCTGGATCACCGGCGATGTCGAGGTTGTCCTGAGGGATGGACGCGCAAAGTTGGCCCGAGATGACCAAATTCACATTCTCAAGCAACACCGACGTAAAGAACTGGAAACACGGCAAAAACAATATCGATGGATGGAGTGGAACCCTGGCTTCCCCTTGAGCATCGATGCCAAATGCCACAAGGATTTACCCCGTGATATCCAGTTTGATAGTGAAAAAGGAGTGGACTTTGTTCTGAATTACTCCAAAGCGATGGAGAACCTGTTCATCAACCGCTTCATGCACATGTTCCAGTCTTCTTGGAATGACTTCGCCGACTTTGAGAAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ALOX5(240) , ALOX5(240)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Alana N Vagnozzi et al.
Translational psychiatry, 7(12), 1288-1288 (2017-12-19)
Neurodegenerative tauopathies are characterized by pathological accumulation of highly phosphorylated isoforms of tau protein, which leads to progressive neuronal loss. Neuroinflammation often accompanies tau-driven diseases; however, the direct role of neuroinflammation in tauopathies remains unknown. The 5-lipoxygenase (5LO) is a
Hyun Jeong Kwak et al.
Scientific reports, 7(1), 5025-5025 (2017-07-12)
Leukotriene B4 (LTB4) production via the 5-lipoxygenase (5-LO) pathway contributes to the development of insulin resistance in adipose and hepatic tissues, but the role of LTB4 in skeletal muscle is relatively unknown. Here, the authors investigated the role of LTB4
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Olga Scherer et al.
Journal of immunological methods, 422, 118-124 (2015-04-22)
Monocytes are an important constituent of the innate immune system. Therefore, manipulating gene expression of primary human monocytes is a crucial mean to study and characterize the functions of targeted proteins in monocytes. Gene silencing by transfection of cells with
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.