설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRAF6(7189) , TRAF6(7189)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Quanfeng Wu et al.
Cancer cell international, 17, 62-62 (2017-06-09)
To study the mechanism by which epithelial ovarian cancer (EOC)-derived exosomes restore the migration of endothelial cells that is suppressed by TAM-derived exosomes. Exosomes were isolated from TAMs in the ascites of patients with EOC. The effect of exosomes on
Yancan Liang et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 47(6), 583-589 (2018-03-27)
Tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) has been proved to play an important role in tumorigenesis, invasion, and metastasis. However, its precise role salivary adenoid cystic carcinoma (SACC) has not been determined. The aim of this study was
Ge Song et al.
Frontiers in immunology, 12, 649020-649020 (2021-03-16)
Myeloid-derived suppressor cells (MDSCs) are immature heterogeneous cells derived from the bone marrow and they are the major component of the tumor-induced immunosuppressive environment. Tumor necrosis factor receptor-associated factor 6 (TRAF6), an E3 ubiquitin ligase, catalyzes the polyubiquitination of target
Eugenia M Yazlovitskaya et al.
Matrix biology : journal of the International Society for Matrix Biology, 77, 101-116 (2018-09-09)
Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins α3β1, α6β1 and α6β4 are usually co-expressed in cells and bind to
Carrie M Rosenberger et al.
PLoS pathogens, 13(4), e1006305-e1006305 (2017-04-06)
Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.