콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU147491

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF5A

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATATGAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATTGGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCTGAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTGTCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAACTGGCTCCCAGGGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Peixun Han et al.
Cell reports, 31(5), 107610-107610 (2020-05-07)
Ribosome movement is not always smooth and is rather often impeded. For ribosome pauses, fundamental issues remain to be addressed, including where ribosomes pause on mRNAs, what kind of RNA/amino acid sequence causes this pause, and the physiological significance of
Daniel J Puleston et al.
Cell metabolism, 30(2), 352-363 (2019-05-28)
How cells adapt metabolism to meet demands is an active area of interest across biology. Among a broad range of functions, the polyamine spermidine is needed to hypusinate the translation factor eukaryotic initiation factor 5A (eIF5A). We show here that
Hanlin Zhang et al.
Molecular cell, 76(1), 110-125 (2019-09-03)
Failure to make adaptive immune responses is a hallmark of aging. Reduced B cell function leads to poor vaccination efficacy and a high prevalence of infections in the elderly. Here we show that reduced autophagy is a central molecular mechanism

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.