설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
AAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATATGAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATTGGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCTGAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTGTCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAACTGGCTCCCAGGGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EIF5A(1984) , EIF5A(1984)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Cell reports, 31(5), 107610-107610 (2020-05-07)
Ribosome movement is not always smooth and is rather often impeded. For ribosome pauses, fundamental issues remain to be addressed, including where ribosomes pause on mRNAs, what kind of RNA/amino acid sequence causes this pause, and the physiological significance of
Cell metabolism, 30(2), 352-363 (2019-05-28)
How cells adapt metabolism to meet demands is an active area of interest across biology. Among a broad range of functions, the polyamine spermidine is needed to hypusinate the translation factor eukaryotic initiation factor 5A (eIF5A). We show here that
Polyamines Control eIF5A Hypusination, TFEB Translation, and Autophagy to Reverse B Cell Senescence.
Molecular cell, 76(1), 110-125 (2019-09-03)
Failure to make adaptive immune responses is a hallmark of aging. Reduced B cell function leads to poor vaccination efficacy and a high prevalence of infections in the elderly. Here we show that reduced autophagy is a central molecular mechanism
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.