콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU147451

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF31, RP11-468E2.4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCCTTGAAGGAGAAGCACATCACAGACATGGTGTGCCCTGCCTGTGGCCGCCCCGACCTCACCGATGACACACAGTTGCTCAGCTACTTCTCTACCCTTGACATCCAGCTTCGCGAGAGCCTAGAGCCAGATGCCTATGCGTTGTTCCATAAGAAGCTGACCGAGGGTGTGCTGATGCGGGACCCCAAGTTCTTGTGGTGTGCCCAGTGCTCCTTTGGCTTCATATATGAGCGTGAGCAGCTGGAGGCAACTTGTCCCCAGTGTCACCAGACCTTCTGTGTGCGCTGCAAGCGCCAGTGGGAGGAGCAGCACCGAGGTCGGAGCTGTGAGGACTTCCAGAACTGGAAACGCATGAACGACCCAGAATACCAGGCCCAGGGCCTAGCAATGTATCTTCAGGAAAACGGCATTGACTGCCCCAAATGCAAGTTCTCGTACGCC

Ensembl | 인체 수납 번호

ENSG00000092098

NCBI 수납 번호

NM_017999

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RNF31(55072) , RNF31(55072)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.