콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU146271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF1A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCAGTTCACCCATGCAGGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAGGGCGGAATGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACGGAGGTGCGTGTCTACAACTGGTTTGCCAACC

Ensembl | 인체 수납 번호

ENSG00000135100

NCBI 수납 번호

NM_000545

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HNF1A(6927) , HNF1A(6927)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ethan V Abel et al.
eLife, 7 (2018-08-04)
The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC
Oğuzhan Fatih Baltacı et al.
Turkish journal of medical sciences, 48(3), 620-627 (2018-06-20)
Background/aim: MODY3 associated with HNF1A is the most common form of MODY and is clinically misdiagnosed as type 1 diabetes due to similar clinical symptoms. This study aimed to analyze the role of HNF1A-regulated miRNAs as a biomarker in the
Shipra Shukla et al.
Cancer cell, 32(6), 792-806 (2017-11-21)
Prostate cancer exhibits a lineage-specific dependence on androgen signaling. Castration resistance involves reactivation of androgen signaling or activation of alternative lineage programs to bypass androgen requirement. We describe an aberrant gastrointestinal-lineage transcriptome expressed in ∼5% of primary prostate cancer that
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Weigong Zhao et al.
International journal of molecular sciences, 16(5), 11699-11712 (2015-05-27)
MicroRNAs (miRNAs) have been reported to have diverse biological roles in regulating many biological processes, including osteogenic differentiation. In the present study, we identified that miR-24 was a critical regulator during osteogenic differentiation. We found that overexpression of miR-24 significantly

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.