콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU145621

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAAAGTGAAGAAGGCCCGTATAGCCATGGGTGGAGGCATAATTTTCATCGTGGCAGGTCTTGCCGCCTTGGTAGCTTGCTCCTGGTATGGCCATCAGATTGTCACAGACTTTTATAACCCTTTGATCCCTACCAACATTAAGTATGAGTTTGGCCCTGCCATCTTTATTGGCTGGGCAGGGTCTGCCCTAGTCATCCTGGGAGGTGCACTGCTCTCCTGTTCCTGTCCTGGGAATGAGAGCAAGGCTGGGTACCGTGTACCCCGCTCTTACCCTAAGTCCAACTCTTCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCTGAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Di Gao et al.
Theriogenology, 158, 346-357 (2020-10-11)
Trophectoderm (TE) barrier function is an essential prerequisite for blastocyst development. CLAUDIN7 (CLDN7), a member of CLAUDINS family, is involved in regulating intercellular exchange and cell polarity in epithelium cells. However, the role of CLDN7 in porcine early embryo development
Thanh Q Dang et al.
The Journal of endocrinology, 234(2), 101-114 (2017-07-15)
Altered permeability of the endothelial barrier in a variety of tissues has implications both in disease pathogenesis and treatment. Glucocorticoids are potent mediators of endothelial permeability, and this forms the basis for their heavily prescribed use as medications to treat
Norimitsu Okui et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 19(1), 88-96 (2018-11-13)
Pancreatic cancer consists of various subpopulations of cells, some of which have aggressive proliferative properties. The molecules responsible for the aggressive proliferation of pancreatic cancer may become molecular targets for the therapies against pancreatic cancer. From a human pancreatic cancer
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.