콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU143271

Sigma-Aldrich

MISSION® esiRNA

targeting human ILK

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | 인체 수납 번호

ENSG00000166333

NCBI 수납 번호

NM_001014794

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ILK(3611) , ILK(3611)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JUU
KNU
ZDS
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Patricia Sosa et al.
Aging and disease, 9(5), 769-784 (2018-10-03)
In mammalians, advancing age is associated with sarcopenia, the progressive and involuntary loss of muscle mass and strength. Hyperphosphatemia is an aging-related condition involved in several pathologies. The aim of this work was to assess whether hyperphosphatemia plays a role
Xiu-Mei Yang et al.
Investigative ophthalmology & visual science, 59(5), 1779-1789 (2018-04-04)
Vasculogenesis has been shown to contribute to the formation of choroidal neovascularization (CNV). However, the mechanism behind the recruitment of endothelial progenitor cells (EPC) to CNV is not well understood. Therefore, we were interested to know whether integrin-linked kinase (ILK)
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
A Shvab et al.
Oncogene, 35(5), 549-557 (2015-04-29)
Overactivation of Wnt-β-catenin signaling, including β-catenin-TCF target gene expression, is a hallmark of colorectal cancer (CRC) development. We identified the immunoglobulin family of cell-adhesion receptors member L1 as a β-catenin-TCF target gene preferentially expressed at the invasive edge of human
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.