설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAATCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACACTGCCGAGCTCAAGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RELA(5970) , RELA(5970)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xiu-Lei Zhang et al.
Biochimica et biophysica acta. General subjects, 1863(10), 1443-1457 (2019-05-20)
Lung cancer is the leading cause of global cancer deaths. Current chemotherapeutic agents for lung cancer treatment are generally accompanied with severe side effects. Here, we report that marchantin C (Mar-C), a potential natural compound with little chemotherapeutic toxicity, exerts
Zhi-Yuan Li et al.
Aging, 8(10), 2337-2354 (2016-10-08)
The corneal epithelium plays important roles in the maintenance of corneal transparency for good vision, and acts as a protective barrier against foreign insults. Structural and functional changes with aging in the corneal epithelium have been documented. Here we found
Masayuki Hiraki et al.
Signal transduction and targeted therapy, 3, 13-13 (2018-05-16)
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in
Ichiro Yajima et al.
Archives of toxicology, 91(11), 3507-3516 (2017-05-05)
Chronic exposure to arsenic is associated with various diseases in humans. Skin hyperpigmentation is the most sensitive objective symptom for patients with arsenicosis. However, there is very limited information about the mechanism of arsenic-mediated skin hyperpigmentation in vivo. In this
Qiang Liu et al.
Nephron, 139(4), 349-358 (2018-05-24)
Given the importance of neutrophil recruitment in the pathogenesis of glomerulonephritis (GN), the representative neutrophil chemoattractant C-X-C motif chemokine 1 (CXCL1)/GROα and the adhesion molecule E-selectin in glomerular endothelial cells (GECs) play a pivotal role in the development of GN.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU141461-50UG | 4061831375893 |
| EHU141461-20UG | 4061831365238 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.