설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Remant Kc et al.
Stem cells and development, 28(11), 734-744 (2018-12-27)
Nonviral gene therapy with specific short interfering RNAs (siRNAs) against BCR-Abl can be an alternative and/or supportive therapy of chronic myeloid leukemia (CML) with tyrosine kinase inhibitors (TKIs), given the often observed resistance to TKIs in clinical setting. In this
X Wang et al.
Scientific reports, 8(1), 1002-1002 (2018-01-19)
Exploration of human pulmonary artery endothelial cell (EC) as a prototypical biomechanical system has important pathophysiologic relevance because this cell type plays a key role in the development of a wide variety of clinical conditions. The complex hierarchical organization ranging
Stephen D S McCarthy et al.
Journal of acquired immune deficiency syndromes (1999), 82(4), 407-415 (2019-10-29)
Previous studies support dasatinib as a potent inhibitor of HIV-1 replication. However, a functional distinction between 2 kinase targets of the drug, ABL1 and ARG, has not been assessed. We used primary CD4 T-cells, CD8-depleted peripheral blood mononuclear cells (PBMCs)
K C Remant et al.
Journal of biomedical materials research. Part A, 108(3), 565-580 (2019-11-13)
Synthetic siRNA technology has emerged as a promising approach for molecular therapy of cancer but, despite its potential for post-transcriptional gene silencing, there is an urgent need to develop efficient delivery systems particularly for difficult-to-transfect, anchorage-independent cells. In this study
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.