설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTACAGATGCCCACAACCTGCACTCCCTCACCTCCATCGTGGACAGCATCACAGTGGAAGATGTGTCTGTGGCCTTCCCAGATGAAACCATGCCCAACTGAGATTGTCTTCCAAGCCGGGCATCCTTGCGAGCCCCCCAAGCTGGCCACAGATGCCACTACTTCTGTAGCAGGGGCCTCCTAAGCCAGGCTGCCCTGATGCTAGGAAGCCAGCTCTGGGGTGCCATAGGCCAGACTATCCCCTTCCTCATCCATGTAAGGTTAACCCACCCCCCAGCAAGGGACTGGACGCCCTCATTCAGCTGCCTCCTTAGAGGAGAGGGCATCCCCTTTCCAGGGAGGTAAAGCAGGGGACCAGAGCGCCCCCTCGTGTATGCCCCAGCTCAGGGGGCAAACTCAGGAGCTTCCTTTTTATCATAACGCGGCCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MYOG(4656) , MYOG(4656)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Chi Yan et al.
International journal of molecular sciences, 16(10), 25014-25030 (2015-10-23)
Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of
Adeel Malik et al.
PloS one, 10(7), e0133597-e0133597 (2015-07-23)
Muscle, a multinucleate syncytium formed by the fusion of mononuclear myoblasts, arises from quiescent progenitors (satellite cells) via activation of muscle-specific transcription factors (MyoD, Myf5, myogenin: MYOG, and MRF4). Subsequent to a decline in Pax7, induction in the expression of
Sae-Won Lee et al.
Scientific reports, 5, 16523-16523 (2015-11-14)
Skeletal muscle regeneration occurs continuously to repair muscle damage incurred during normal activity and in chronic disease or injury. Herein, we report that A-kinase anchoring protein 6 (AKAP6) is important for skeletal myoblast differentiation and muscle regeneration. Compared with unstimulated
Majid Rasool Kamli et al.
Biochemical and biophysical research communications, 450(4), 1291-1296 (2014-07-06)
Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are
Global Trade Item Number
SKU | GTIN |
---|---|
EHU138681-20UG | 4061831364927 |
EHU138681-50UG | 4061828411917 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.