콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU138141

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGCAGAGTGCAAGAGATGCCTCAGTCAAGTCAGCCAAAAACACGCGGGTCATCCCCAAGCCCCAGAGAGTGACAGAGCCCCGATGACACGGACACCTCGGCTGCTGTCACTTCCCTGGTTCGGGCCTCCCACAGGCTTTGAATTGAAGGCGAGTGCCTCAGAATTTGCATCCATTGTTCTGTCTTTCCTGGGAAGTTATTCATCCTGGTGGCCAGCCCACCGACAAAATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGGTAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTGGCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ramon Lopez Perez et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 133, 77-86 (2019-04-03)
Carbon ion radiotherapy is a promising therapeutic option for glioblastoma patients due to its high physical dose conformity and greater biological effectiveness than photons. However, the biological effects of carbon ion radiation are still incompletely understood. Here, we systematically compared
Wynand P Roos et al.
Cancer letters, 424, 119-126 (2018-03-27)
Glioblastoma is the most frequent and aggressive form of high-grade malignant glioma. Due to the dismal prognosis faced by patients suffering from this disease, there is a need for identifying new targets that might improve therapy. The aim of this
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.