콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU138031

Sigma-Aldrich

MISSION® esiRNA

targeting human ICAM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wei Gu et al.
Oncotarget, 8(67), 111882-111901 (2018-01-18)
Intercellular adhesion molecule-1 is the adhesion molecule mediating leukocyte firm adhesion to endothelial cells, plays a critical role in subsequent leukocyte transmigration. ICAM-1 is also expressed in other cells including macrophages; however, the role of this adhesion molecule in mediating
Pei-Yue Jiang et al.
American journal of translational research, 11(9), 6249-6261 (2019-10-22)
We aimed to investigate the value of cholestasis-related miRNAs in the diagnosis of intra-hepatic cholestasis of pregnancy (ICP) as well as the molecular mechanisms underlying the role of these miRNAs in the pathogenesis of ICP. In this study, electron microscopy
Dejun Xu et al.
Biological chemistry, 401(5), 601-615 (2019-12-22)
Long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been identified as a regulatory molecule in angiogenesis. The goal of this study was to illustrate how MEG3 affects the angiogenesis of vascular endothelial cells. Expression of MEG3, miR-147 and
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central
Hannah L Wiesolek et al.
The American journal of pathology, 190(4), 874-885 (2020-02-09)
Intercellular adhesion molecule-1 (ICAM-1) is up-regulated during inflammation by several cell types. ICAM-1 is best known for its role in mediating leukocyte adhesion to endothelial cells and guiding leukocytes across the vascular wall. Recently, macrophages have been shown to express

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.