콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU136211

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTTGAGGGCACATGCAGTAGATATTAATGGAAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGACAACAGACCTGAGTTCTTACACCAGGTTTGGAATGGGACAGTTCCTGAGGGATCAAAGCCTGGAACATATGTGATGACCGTAACAGCAATTGATGCTGACGATCCCAATGCCCTCAATGGGATGTTGAGGTACAGAATCGTGTCTCAGGCTCCAAGCACCCCTTCACCCAACATGTTTACAATCAACAATGAGACTGGTGACATCATCACAGTGGCAGCTGGACTTGATCGAGAAAAAGTGCAACAGTATACGTTAATAATTCAAGCTACAGACATGGAAGGCAATCCCACATATGGCCTTTCAAACACAGCCACGGCCGTCATCACAGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACGTTTTATGGTGAAGTTCCTGAGAACAGGGTAGACATCATAGTAGCTAATCTAACTGTGACCGATAAGGATCAACCCCATACACCA

Ensembl | 인체 수납 번호

ENSG00000170558

NCBI 수납 번호

NM_001792

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CDH2(1000) , CDH2(1000)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hsien-Ming Wu et al.
Oncotarget, 8(3), 4410-4421 (2016-12-30)
More than 25% of patients diagnosed with endometrial carcinoma have invasive primary cancer accompanied by metastases. Growth hormone-releasing hormone (GHRH) plays an important role in reproduction. Here, we examined the effect of a GHRH antagonist on the motility of endometrial
Bo Xu et al.
Nature biotechnology (2018-11-27)
The efficacy of oncolytic herpes simplex virus (oHSV) is limited by rapid viral clearance by innate immune effector cells and poor intratumoral viral spread. We combine two approaches to overcome these barriers: inhibition of natural killer (NK) cells and enhancement
Ciqing Yang et al.
Histochemistry and cell biology, 151(3), 239-248 (2018-09-27)
N-cadherin, a member of the cadherin family, plays an important role in neural development. In addition, N-cadherin has been reported to be crucial in neuronal migration, axonal outgrowth, and axonal path-finding. However, the mechanism underlying the effects of N-cadherin in
Srikanth R Polusani et al.
Journal of cell science, 129(23), 4399-4410 (2016-11-02)
Gap junction proteins (connexins) have crucial effects on cell motility in many systems, from migration of neural crest cells to promotion of metastatic invasiveness. Here, we show that expression of Cx26 (also known as GJB2) in HeLa cells specifically enhances
Ciqing Yang et al.
Journal of molecular histology, 47(6), 541-554 (2016-09-22)
N-cadherin is a calcium-sensitive cell adhesion molecule that plays an important role in the formation of the neural circuit and the development of the nervous system. In the present study, we investigated the function of N-cadherin in cell-cell connection in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.