콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU135581

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCTTCCCTCCTGTTCTCTGGTTATAGCTGGTCCCAGGTCAGCGTGGGAGGCACCTTTGGGTTCCCAGTGCCCAGCACTTTGTAGTCTCATCCCAGATTACTAACCCTTCCTGATCCTGGAGAGGCAGGGATAGTAAATAAATTGCTCTTCCTACCCCATCCCCCATCCCCTGACAAAAAGTGACGGCAGCCGTACTGAGTCTGTAAGGCCCAAAGTGGGTACAGACAGCCTGGGCTGGTAAAAGTAGGTCCTTATTTACAAGGCTGCGTTAAAGTTGTACTAGGCAAACACACTGATGTAGGAAGCACGAGGAAAGGA

Ensembl | 인체 수납 번호

ENSG00000020633

NCBI 수납 번호

NM_001031680

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RUNX3(864) , RUNX3(864)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bufeng Zhuang et al.
Molecular medicine reports, 19(5), 3933-3940 (2019-03-01)
Dysregulated microRNAs (miRNAs/miRs) directly modulate the biological functions of non‑small cell lung cancer (NSCLC) cells and contribute to the initiation and progression of NSCLC; however, the specific roles and underlying mechanisms of the dysregulated miRNAs in NSCLC require further investigation.
J Justin Milner et al.
Nature, 552(7684), 253-257 (2017-12-07)
Tissue-resident memory CD8
Jikui Sun et al.
Oncotarget, 8(67), 110785-110796 (2018-01-18)
Accumulating data demonstrates that the network dysregulation of microRNA-medicated target genes is involved in glioma. We have previously found miR-19a/b overexpression in glioma cell lines and specimens with various tumour grades. However, there was no report on the function and
Haiping Yang et al.
International journal of molecular medicine, 40(5), 1466-1476 (2017-09-28)
Bronchopulmonary dysplasia (BPD) is a major challenge for premature infants; however, the underlying mechanisms remain unclear. We previously reported that epithelial-mesenchymal transition (EMT) in alveolar type II (AT2) epithelial cells influences the normal alveolar development process. In this study, we wished to examine whether
Lin Shi et al.
Cell stress & chaperones, 25(5), 793-802 (2020-07-19)
Lung toxicity is the main cause of the death from methamphetamine (MA) abuse, but its mechanism has remained unclear. The purpose of our study was to investigate if MA can induce epithelial-to-mesenchymal transition (EMT) and if RUNX3 is involved in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.