추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TTGCTGTCATTCAGCTTTGGACAGTCCGCCATCTTTCTCCTGGGTGGTCTTCAAAGGGATGAGGCCCCCACGGCCATGTTTATGCACAGTGGTGACATCATGATAATGTCGGGTTTCAGCCGCCTCTTGAACCACGCAGTCCCTCGTGTCCTTCCAAATCCAGAAGGGGAAGGCCTGCCTCACTGCCTAGAGGCACCTCTCCCTGCTGTCCTCCCGAGAGATTCAATGGTAGAGCCTTGTTCTATGGAGGACTGGCAGGTGTGTGCCAGCTACTTGAAGACCGCTCGTGTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ALKBH1(8846) , ALKBH1(8846)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Chuan-Le Xiao et al.
Molecular cell, 71(2), 306-318 (2018-07-19)
DNA N6-methyladenine (6mA) modification is the most prevalent DNA modification in prokaryotes, but whether it exists in human cells and whether it plays a role in human diseases remain enigmatic. Here, we showed that 6mA is extensively present in the
Lianpin Wu et al.
Cell death & disease, 10(12), 909-909 (2019-12-05)
Modification of the novel N6-methyladenine (m6A) DNA implicates this epigenetic mark in human malignant disease, but its role in atherosclerosis (AS) is largely unknown. Here, we found that the leukocyte level of m6A but not 5mC DNA modification was decreased
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.