콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU134141

Sigma-Aldrich

MISSION® esiRNA

targeting human NFYA

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGTCATCTGGACCATCGTACTTGCTGTGGCTACTTCTAAGACAATGTAGAGGGTTATTAAACCTTGAAACTGCCTTTCCTAAGTAGAGAACAAGACTATTCAACAACTTCTTTGCTGAAGCACTGAGGAGATTTGTAATACTCCTAAAGGAAGGGCCAAACTAGAGATTTTCAATCATAGACTTTGTGACAGCATTTGGGGAACTAAAAGATTCATGTGTTTCAGCCTAGTGGGAGAGAGTGGGGGAGAGGAAGAGAGAGAGAGAGCATGTATACCCGTATGTTATCATAGAGCACGATTCTCCAGTGGATGGATACCTGGAATGGATCATTAAGATGAAGAGAGTAATTCACATTTACTCTAGAACCTTTAACAAGCACTGAAAGGAAGAAGCCTGAGATTTGATCCTTGACAATTTCTGGAAAGCACTGGTCAGTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hongxin Ma et al.
Oncotarget, 6(2), 1049-1063 (2014-12-05)
We previously reported the tumor suppressor function of Zinc-fingers and homeoboxes 2 (ZHX2) in hepatocellular carcinoma (HCC). Other studies indicate the association of increased ZHX2 expression with improved response to high dose chemotherapy in multiple myeloma. Here, we aim to
Zhongcheng Shi et al.
Nucleic acids research, 43(13), 6257-6269 (2015-06-05)
Roles for SOX9 have been extensively studied in development and particular emphasis has been placed on SOX9 roles in cell lineage determination in a number of discrete tissues. Aberrant expression of SOX9 in many cancers, including colorectal cancer, suggests roles
Siyuan Ding et al.
PLoS biology, 12(1), e1001758-e1001758 (2014-01-11)
Type III interferon (IFN-λ) exhibits potent antiviral activity similar to IFN-α/β, but in contrast to the ubiquitous expression of the IFN-α/β receptor, the IFN-λ receptor is restricted to cells of epithelial origin. Despite the importance of IFN-λ in tissue-specific antiviral

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.