콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU132881

Sigma-Aldrich

MISSION® esiRNA

targeting human APLNR

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACCATCATGCTGACCTGTTACTTCTTCATCGCCCAAACCATCGCTGGCCACTTCCGCAAGGAACGCATCGAGGGCCTGCGGAAGCGGCGCCGGCTGCTCAGCATCATCGTGGTGCTGGTGGTGACCTTTGCCCTGTGCTGGATGCCCTACCACCTGGTGAAGACGCTGTACATGCTGGGCAGCCTGCTGCACTGGCCCTGTGACTTTGACCTCTTCCTCATGAACATCTTCCCCTACTGCACCTGCATCAGCTACGTCAACAGCTGCCTCAACCCCTTCCTCTATGCCTTTTTCGACCCCCGCTTCCGCCAGGCCTGCACCTCCATGCTCTGCTGTGGCCAGAGCAGGTGCGCAGGCACCTCCCACAGCAGCAGTGGGGAGAAGTCAGCCAGCTACTCTTCGGGGCACAGCCAGGGGCCCGGCCCCAACATGGGCAAGGGTGGAGAACAGATGCACGAGAAATCCATCCCCTA

Ensembl | 인체 수납 번호

ENSG00000134817

NCBI 수납 번호

NM_005161

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... APLNR(187) , APLNR(187)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bingyuan Ji et al.
Cellular signalling, 73, 109671-109671 (2020-05-15)
Apelin receptor (APJ) and bradykinin B2 receptor (B2R) play an important role in many physiological processes and share multiple similar characteristics in distribution and functions in the cardiovascular system. We first identified the endogenous expression of APJ and B2R in
Weilin Xu et al.
Journal of neuroinflammation, 16(1), 247-247 (2019-12-04)
Neuroinflammation and oxidative stress play important roles in early brain injury following subarachnoid hemorrhage (SAH). This study is the first to show that activation of apelin receptor (APJ) by apelin-13 could reduce endoplasmic reticulum (ER)-stress-associated inflammation and oxidative stress after
Lu Zhou et al.
American journal of physiology. Endocrinology and metabolism, 316(5), E773-E781 (2019-03-13)
Preeclampsia (PE) is a major cause of maternal mortality and morbidity worldwide. Although there has been great progress in the understanding of PE, the exact cause for the disease development is still unclear. Recently, studies showed that genetic deletion of
Andrew G Masoud et al.
The Journal of clinical investigation, 130(1), 94-107 (2019-11-19)
Sustained, indolent immune injury of the vasculature of a heart transplant limits long-term graft and recipient survival. This injury is mitigated by a poorly characterized, maladaptive repair response. Vascular endothelial cells respond to proangiogenic cues in the embryo by differentiation
Danai Georgiadou et al.
Scientific reports, 9(1), 19077-19077 (2019-12-15)
Preeclampsia is a frequent gestational hypertensive disorder with equivocal pathophysiology. Knockout of peptide hormone ELABELA (ELA) has been shown to cause preeclampsia-like symptoms in mice. However, the role of ELA in human placentation and whether ELA is involved in the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.