콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU132681

Sigma-Aldrich

MISSION® esiRNA

targeting human IFI16

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGCTCCACCCAACAGTTCTTCAACTGAGAACCCGAAAACAGTGGCCAAATGTCAGGTAACTCCCAGAAGAAATGTTCTCCAAAAACGCCCAGTGATAGTGAAGGTACTGAGTACAACAAAGCCATTTGAATATGAGACCCCAGAAATGGAGAAAAAAATAATGTTTCATGCTACAGTGGCTACACAGACACAGTTCTTCCATGTGAAGGTTTTAAACACCAGCTTGAAGGAGAAATTCAATGGAAAGAAAATCATCATCATATCAGATTATTTGGAATATGATAGTCTCCTAGAGGTCAATGAAGAATCTACTGTATCTGAAGCTGGTCCTAACCAAACGTTTGAGGTTCCAAATAAAATCATCAACAGAGCAAAGGAAACTCTGAAGATTGATATTCTTCACAAACAAGCTTCAGGA

Ensembl | 인체 수납 번호

ENSG00000163565

NCBI 수납 번호

NM_005531

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IFI16(3428) , IFI16(3428)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
FWU
TQU
QCS
SAT
QXR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Cindy Orvain et al.
The Journal of clinical investigation, 130(7), 3777-3790 (2020-04-03)
Hidradenitis suppurativa (HS) is a chronic, relapsing, inflammatory skin disease. HS appears to be a primary abnormality in the pilosebaceous-apocrine unit. In this work, we characterized hair follicle stem cells (HFSCs) isolated from HS patients and more precisely the outer
A Berry et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 24(6), 1700-1713 (2010-01-21)
Previously, we used cDNA expression profiling to identify genes associated with glucocorticoid (Gc) sensitivity. We now identify which of these directly influence Gc action. Interferon-inducible protein 16 (IFI16), bone morphogenetic protein receptor type II (BMPRII), and regulator of G-protein signaling
Stine Søby et al.
Herpesviridae, 3(1), 6-6 (2012-10-16)
Innate recognition is essential in the antiviral response against infection by herpes simplex virus (HSV). Chemokines are important for control of HSV via recruitment of natural killer cells, T lymphocytes, and antigen-presenting cells. We previously found that early HSV-1-mediated chemokine
Xin Duan et al.
PloS one, 6(5), e19532-e19532 (2011-05-17)
Glucose restriction in cells increases the AMP/ATP ratio (energetic stress), which activates the AMPK/p53 pathway. Depending upon the energetic stress levels, cells undergo either autophagy or cell death. Given that the activated p53 induces the expression of IFI16 protein, we
Grazia Rosaria Gariano et al.
PLoS pathogens, 8(1), e1002498-e1002498 (2012-02-01)
Human interferon (IFN)-inducible IFI16 protein, an innate immune sensor of intracellular DNA, modulates various cell functions, however, its role in regulating virus growth remains unresolved. Here, we adopt two approaches to investigate whether IFI16 exerts pro- and/or anti-viral actions. First
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.