콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU131101

Sigma-Aldrich

MISSION® esiRNA

targeting human POLD1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGAGTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCCGGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGTATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGACACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCCCTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qinghong Qin et al.
Oncology letters, 16(5), 5591-5598 (2018-10-23)
Polymerase δ catalytic subunit gene 1 (POLD1) may serve an important function in the development of tumors. However, its role in breast cancer remains unclear. The aim of the present study was to observe the expression and the function of
Albert Job et al.
Scientific reports, 10(1), 18924-18924 (2020-11-05)
Inhibition of the kinase ATR, a central regulator of the DNA damage response, eliminates subsets of cancer cells in certain tumors. As previously shown, this is at least partly attributable to synthetic lethal interactions between ATR and POLD1, the catalytic
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.